kod fx (Toyobo)
Toyobo is a verified supplier 
Toyobo manufactures this product 
97
Structured Review
Toyobo
kod fx
Kod Fx, supplied by Toyobo, used in various techniques. Bioz Stars score: 97/100, based on 5335 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/kod+-plus/KOD+FX/custom%40kfx-101%4042437031
Average 97 stars, based on 5335 article reviews
Kod Fx, supplied by Toyobo, used in various techniques. Bioz Stars score: 97/100, based on 5335 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/kod+-plus/KOD+FX/custom%40kfx-101%4042437031
Average 97 stars, based on 5335 article reviews
kod fx - by Bioz Stars,
2026-09
97/100 stars
Images
Related Articles
Activity Assay:Article Title: A synthetic cell with integrated DNA self-replication and lipid biosynthesis. Article Snippet: .. For activity assays reported in Supplementary Fig. 23, a Article Title: A synthetic cell with integrated DNA self-replication and lipid biosynthesis Article Snippet: .. For activity assays reported in Supplementary Fig. a Variant Assay:Article Title: A synthetic cell with integrated DNA self-replication and lipid biosynthesis. Article Snippet: .. For activity assays reported in Supplementary Fig. 23, a Article Title: A synthetic cell with integrated DNA self-replication and lipid biosynthesis Article Snippet: .. For activity assays reported in Supplementary Fig. a Mutagenesis:Article Title: A synthetic cell with integrated DNA self-replication and lipid biosynthesis. Article Snippet: .. For activity assays reported in Supplementary Fig. 23, a Article Title: A synthetic cell with integrated DNA self-replication and lipid biosynthesis Article Snippet: .. For activity assays reported in Supplementary Fig. a Polymerase Chain Reaction:Article Title: Cis -regulatory evolution of Wnt family genes contributes to a morphological difference between silkworm species Article Snippet: .. Genomic DNA was extracted from the G1 individuals by the HotSHOT method [ ], and PCR was performed using Article Title: Complete genome sequence of Zoysia mosaic virus from Japan. Article Snippet: A template-switching RT enzyme mix (NEB) was used to synthesize complemen tary DNA (cDNA) with this dsRNA and TSO (5′- AAGCAGTGGTATCAACGCAGAGTAC ATrGrGrG-3′, rG: guanine ribonucleotide, underline: common sequence according to procedure protocol: https://www.neb.com/ja-jp/protocols/5-race-protocol-using-thetemplate-switching-rt-enzyme-mix) as template and primer TSO-F1-N6 (5′-AAGCAGTGG TATCAACGCAGAGTTACANNNNNN-3′) as a primer. .. Since the synthesized cDNA contains a common sequence at its 5′ end and a sequence complementary to the common sequence at its 3′ end, Article Title: Overexpression of LpNAC14 from Lilium pumilum enhances salt and drought tolerance in transgenic Nicotiana tabacum. Article Snippet: Lilies are among the most economically important ornamental flowers worldwide, yet their large-scale cultivation is often hindered by limited tolerance to salinity and drought.. Lilium pumilum, a wild lily species native to northern China, exhibits remarkable resilience to salinity, drought, and cold, making it a valuable genetic resource for stress tolerance studies.. In this study, the transcription factor LpNAC14 was identified through transcriptome sequencing analysis and cloned from L. pumilum. Article Title: Anti-clumping factor A and anti-staphylococcal protein A antibodies suppress adhesion of Staphylococcus aureus to bovine mammary epithelial cells. Article Snippet: Staphylococcus aureus causes mastitis, which results in large economic losses in the dairy industry.. The adhesion of S. aureus to the mammary epithelium is a critical first step in the pathogenesis of mastitis.. S. aureus expresses several adhesins, including clumping factor A (ClfA) and staphylococcal protein A (SpA). Synthesized:Article Title: Complete genome sequence of Zoysia mosaic virus from Japan. Article Snippet: A template-switching RT enzyme mix (NEB) was used to synthesize complemen tary DNA (cDNA) with this dsRNA and TSO (5′- AAGCAGTGGTATCAACGCAGAGTAC ATrGrGrG-3′, rG: guanine ribonucleotide, underline: common sequence according to procedure protocol: https://www.neb.com/ja-jp/protocols/5-race-protocol-using-thetemplate-switching-rt-enzyme-mix) as template and primer TSO-F1-N6 (5′-AAGCAGTGG TATCAACGCAGAGTTACANNNNNN-3′) as a primer. .. Since the synthesized cDNA contains a common sequence at its 5′ end and a sequence complementary to the common sequence at its 3′ end, Sequencing:Article Title: Complete genome sequence of Zoysia mosaic virus from Japan. Article Snippet: A template-switching RT enzyme mix (NEB) was used to synthesize complemen tary DNA (cDNA) with this dsRNA and TSO (5′- AAGCAGTGGTATCAACGCAGAGTAC ATrGrGrG-3′, rG: guanine ribonucleotide, underline: common sequence according to procedure protocol: https://www.neb.com/ja-jp/protocols/5-race-protocol-using-thetemplate-switching-rt-enzyme-mix) as template and primer TSO-F1-N6 (5′-AAGCAGTGG TATCAACGCAGAGTTACANNNNNN-3′) as a primer. .. Since the synthesized cDNA contains a common sequence at its 5′ end and a sequence complementary to the common sequence at its 3′ end, Article Title: Overexpression of LpNAC14 from Lilium pumilum enhances salt and drought tolerance in transgenic Nicotiana tabacum. Article Snippet: Lilies are among the most economically important ornamental flowers worldwide, yet their large-scale cultivation is often hindered by limited tolerance to salinity and drought.. Lilium pumilum, a wild lily species native to northern China, exhibits remarkable resilience to salinity, drought, and cold, making it a valuable genetic resource for stress tolerance studies.. In this study, the transcription factor LpNAC14 was identified through transcriptome sequencing analysis and cloned from L. pumilum. Plasmid Preparation:Article Title: Endoplasmic reticulum patterns insect cuticle nanostructure Article Snippet: .. To build the donor plasmid, 1 kb each of the 5′ and-3′ homology arms flanking the target site were amplified using Amplification:Article Title: Endoplasmic reticulum patterns insect cuticle nanostructure Article Snippet: .. To build the donor plasmid, 1 kb each of the 5′ and-3′ homology arms flanking the target site were amplified using Article Title: Overexpression of LpNAC14 from Lilium pumilum enhances salt and drought tolerance in transgenic Nicotiana tabacum. Article Snippet: Lilies are among the most economically important ornamental flowers worldwide, yet their large-scale cultivation is often hindered by limited tolerance to salinity and drought.. Lilium pumilum, a wild lily species native to northern China, exhibits remarkable resilience to salinity, drought, and cold, making it a valuable genetic resource for stress tolerance studies.. In this study, the transcription factor LpNAC14 was identified through transcriptome sequencing analysis and cloned from L. pumilum. Article Title: Anti-clumping factor A and anti-staphylococcal protein A antibodies suppress adhesion of Staphylococcus aureus to bovine mammary epithelial cells. Article Snippet: Staphylococcus aureus causes mastitis, which results in large economic losses in the dairy industry.. The adhesion of S. aureus to the mammary epithelium is a critical first step in the pathogenesis of mastitis.. S. aureus expresses several adhesins, including clumping factor A (ClfA) and staphylococcal protein A (SpA). Construct:Article Title: Endoplasmic reticulum patterns insect cuticle nanostructure Article Snippet: .. To build the donor plasmid, 1 kb each of the 5′ and-3′ homology arms flanking the target site were amplified using Cloning:Article Title: Overexpression of LpNAC14 from Lilium pumilum enhances salt and drought tolerance in transgenic Nicotiana tabacum. Article Snippet: Lilies are among the most economically important ornamental flowers worldwide, yet their large-scale cultivation is often hindered by limited tolerance to salinity and drought.. Lilium pumilum, a wild lily species native to northern China, exhibits remarkable resilience to salinity, drought, and cold, making it a valuable genetic resource for stress tolerance studies.. In this study, the transcription factor LpNAC14 was identified through transcriptome sequencing analysis and cloned from L. pumilum. Purification:Article Title: Overexpression of LpNAC14 from Lilium pumilum enhances salt and drought tolerance in transgenic Nicotiana tabacum. Article Snippet: Lilies are among the most economically important ornamental flowers worldwide, yet their large-scale cultivation is often hindered by limited tolerance to salinity and drought.. Lilium pumilum, a wild lily species native to northern China, exhibits remarkable resilience to salinity, drought, and cold, making it a valuable genetic resource for stress tolerance studies.. In this study, the transcription factor LpNAC14 was identified through transcriptome sequencing analysis and cloned from L. pumilum. Real-time Polymerase Chain Reaction:Article Title: Overexpression of LpNAC14 from Lilium pumilum enhances salt and drought tolerance in transgenic Nicotiana tabacum. Article Snippet: Lilies are among the most economically important ornamental flowers worldwide, yet their large-scale cultivation is often hindered by limited tolerance to salinity and drought.. Lilium pumilum, a wild lily species native to northern China, exhibits remarkable resilience to salinity, drought, and cold, making it a valuable genetic resource for stress tolerance studies.. In this study, the transcription factor LpNAC14 was identified through transcriptome sequencing analysis and cloned from L. pumilum. |